Home > Research > Publications & Outputs > Corrigendum to “Visualisation of Mycobacterium ...

Links

Text available via DOI:

View graph of relations

Corrigendum to “Visualisation of Mycobacterium avium subsp. paratuberculosis in cultured cells, infected sheep and human tissue sections using fluorescent in situ hybridization (FISH)” [Journal of Microbiological Methods 224 (2024) 107001] (Journal of Microbiological Methods (2024) 224, (S0167701224001131), (10.1016/j.mimet.2024.107001))

Research output: Contribution to Journal/MagazineComment/debatepeer-review

Published
  • Neil Rayment
  • Glenn Rhodes
  • Barry Hudspith
  • Valerie Hughes
  • Francesca Chianini
  • Gaurav Agrawal
  • Tim J. Bull
  • Roger Pickup
  • Jeremy Sanderson
Close
Article number107024
<mark>Journal publication date</mark>31/10/2024
<mark>Journal</mark>Journal of Microbiological Methods
Volume225
Publication StatusPublished
Early online date13/09/24
<mark>Original language</mark>English

Abstract

The authors regret that an incorrect sequence was included in line 47 of our submitted manuscript which omitted the inclusion of the two extra GC nucleotides at positions 7&8 n the sequence. Currently the manuscript reads “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions -7 and -8, termed P90CorrProbe (5’-GTTCGGGGCCGTCGCTTAGG-3’).” but should have read “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions −7 and −8, termed P90CorrProbe (5′GTTCGGGGCCGTCGGCCTTAGG–3′). The authors would like to apologise for any inconvenience caused.