Final published version
Licence: CC BY-NC: Creative Commons Attribution-NonCommercial 4.0 International License
Research output: Contribution to Journal/Magazine › Comment/debate › peer-review
Article number | 107024 |
---|---|
<mark>Journal publication date</mark> | 31/10/2024 |
<mark>Journal</mark> | Journal of Microbiological Methods |
Volume | 225 |
Publication Status | Published |
Early online date | 13/09/24 |
<mark>Original language</mark> | English |
The authors regret that an incorrect sequence was included in line 47 of our submitted manuscript which omitted the inclusion of the two extra GC nucleotides at positions 7&8 n the sequence. Currently the manuscript reads “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions -7 and -8, termed P90CorrProbe (5’-GTTCGGGGCCGTCGCTTAGG-3’).” but should have read “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions −7 and −8, termed P90CorrProbe (5′GTTCGGGGCCGTCGGCCTTAGG–3′). The authors would like to apologise for any inconvenience caused.