Final published version
Licence: CC BY-NC: Creative Commons Attribution-NonCommercial 4.0 International License
Research output: Contribution to Journal/Magazine › Comment/debate › peer-review
Research output: Contribution to Journal/Magazine › Comment/debate › peer-review
}
TY - JOUR
T1 - Corrigendum to “Visualisation of Mycobacterium avium subsp. paratuberculosis in cultured cells, infected sheep and human tissue sections using fluorescent in situ hybridization (FISH)” [Journal of Microbiological Methods 224 (2024) 107001] (Journal of Microbiological Methods (2024) 224, (S0167701224001131), (10.1016/j.mimet.2024.107001))
AU - Rayment, Neil
AU - Rhodes, Glenn
AU - Hudspith, Barry
AU - Hughes, Valerie
AU - Chianini, Francesca
AU - Agrawal, Gaurav
AU - Bull, Tim J.
AU - Pickup, Roger
AU - Sanderson, Jeremy
PY - 2024/10/31
Y1 - 2024/10/31
N2 - The authors regret that an incorrect sequence was included in line 47 of our submitted manuscript which omitted the inclusion of the two extra GC nucleotides at positions 7&8 n the sequence. Currently the manuscript reads “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions -7 and -8, termed P90CorrProbe (5’-GTTCGGGGCCGTCGCTTAGG-3’).” but should have read “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions −7 and −8, termed P90CorrProbe (5′GTTCGGGGCCGTCGGCCTTAGG–3′). The authors would like to apologise for any inconvenience caused.
AB - The authors regret that an incorrect sequence was included in line 47 of our submitted manuscript which omitted the inclusion of the two extra GC nucleotides at positions 7&8 n the sequence. Currently the manuscript reads “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions -7 and -8, termed P90CorrProbe (5’-GTTCGGGGCCGTCGCTTAGG-3’).” but should have read “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions −7 and −8, termed P90CorrProbe (5′GTTCGGGGCCGTCGGCCTTAGG–3′). The authors would like to apologise for any inconvenience caused.
U2 - 10.1016/j.mimet.2024.107024
DO - 10.1016/j.mimet.2024.107024
M3 - Comment/debate
C2 - 39214850
AN - SCOPUS:85202809963
VL - 225
JO - Journal of Microbiological Methods
JF - Journal of Microbiological Methods
SN - 0167-7012
M1 - 107024
ER -