Home > Research > Publications & Outputs > Corrigendum to “Visualisation of Mycobacterium ...

Links

Text available via DOI:

View graph of relations

Corrigendum to “Visualisation of Mycobacterium avium subsp. paratuberculosis in cultured cells, infected sheep and human tissue sections using fluorescent in situ hybridization (FISH)” [Journal of Microbiological Methods 224 (2024) 107001] (Journal of Microbiological Methods (2024) 224, (S0167701224001131), (10.1016/j.mimet.2024.107001))

Research output: Contribution to Journal/MagazineComment/debatepeer-review

Published

Standard

Harvard

APA

Vancouver

Author

Bibtex

@article{92651fc31cb248488f267b9efd7978d3,
title = "Corrigendum to “Visualisation of Mycobacterium avium subsp. paratuberculosis in cultured cells, infected sheep and human tissue sections using fluorescent in situ hybridization (FISH)” [Journal of Microbiological Methods 224 (2024) 107001] (Journal of Microbiological Methods (2024) 224, (S0167701224001131), (10.1016/j.mimet.2024.107001))",
abstract = "The authors regret that an incorrect sequence was included in line 47 of our submitted manuscript which omitted the inclusion of the two extra GC nucleotides at positions 7&8 n the sequence. Currently the manuscript reads “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions -7 and -8, termed P90CorrProbe (5{\textquoteright}-GTTCGGGGCCGTCGCTTAGG-3{\textquoteright}).” but should have read “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions −7 and −8, termed P90CorrProbe (5′GTTCGGGGCCGTCGGCCTTAGG–3′). The authors would like to apologise for any inconvenience caused.",
author = "Neil Rayment and Glenn Rhodes and Barry Hudspith and Valerie Hughes and Francesca Chianini and Gaurav Agrawal and Bull, {Tim J.} and Roger Pickup and Jeremy Sanderson",
year = "2024",
month = oct,
day = "31",
doi = "10.1016/j.mimet.2024.107024",
language = "English",
volume = "225",
journal = "Journal of Microbiological Methods",
issn = "0167-7012",
publisher = "Elsevier",

}

RIS

TY - JOUR

T1 - Corrigendum to “Visualisation of Mycobacterium avium subsp. paratuberculosis in cultured cells, infected sheep and human tissue sections using fluorescent in situ hybridization (FISH)” [Journal of Microbiological Methods 224 (2024) 107001] (Journal of Microbiological Methods (2024) 224, (S0167701224001131), (10.1016/j.mimet.2024.107001))

AU - Rayment, Neil

AU - Rhodes, Glenn

AU - Hudspith, Barry

AU - Hughes, Valerie

AU - Chianini, Francesca

AU - Agrawal, Gaurav

AU - Bull, Tim J.

AU - Pickup, Roger

AU - Sanderson, Jeremy

PY - 2024/10/31

Y1 - 2024/10/31

N2 - The authors regret that an incorrect sequence was included in line 47 of our submitted manuscript which omitted the inclusion of the two extra GC nucleotides at positions 7&8 n the sequence. Currently the manuscript reads “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions -7 and -8, termed P90CorrProbe (5’-GTTCGGGGCCGTCGCTTAGG-3’).” but should have read “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions −7 and −8, termed P90CorrProbe (5′GTTCGGGGCCGTCGGCCTTAGG–3′). The authors would like to apologise for any inconvenience caused.

AB - The authors regret that an incorrect sequence was included in line 47 of our submitted manuscript which omitted the inclusion of the two extra GC nucleotides at positions 7&8 n the sequence. Currently the manuscript reads “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions -7 and -8, termed P90CorrProbe (5’-GTTCGGGGCCGTCGCTTAGG-3’).” but should have read “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions −7 and −8, termed P90CorrProbe (5′GTTCGGGGCCGTCGGCCTTAGG–3′). The authors would like to apologise for any inconvenience caused.

U2 - 10.1016/j.mimet.2024.107024

DO - 10.1016/j.mimet.2024.107024

M3 - Comment/debate

C2 - 39214850

AN - SCOPUS:85202809963

VL - 225

JO - Journal of Microbiological Methods

JF - Journal of Microbiological Methods

SN - 0167-7012

M1 - 107024

ER -